Sequence retrieval

Genome: Prosthecochloris vibrioformis DSM 265
Start position: 1682795
End position: 1682824
Length: 30

DNA sequence
>NC_009337, from 1682795 to 1682824 (30 bp); Prosthecochloris vibrioformis DSM 265 CATAAAAACACAGAAAAAGATATAAAAAAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 1681443-1682798	Sequence	Cvib_1510 - MiaB-like tRNA modifying protein (Protein is coded in complementary strand; from 1682798 to 1681443)