Sequence retrieval

Genome: Prosthecochloris vibrioformis DSM 265
Start position: 1370500
End position: 1370527
Length: 28

DNA sequence
>NC_009337, from 1370500 to 1370527 (28 bp); Prosthecochloris vibrioformis DSM 265 AGTGCTGAGTTCTGAGTTCTGAGTTCTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1369483-1370541	Sequence	Cvib_1219 - NAD-dependent epimerase/dehydratase (Protein is coded in complementary strand; from 1370541 to 1369483)