Sequence retrieval

Genome: Prosthecochloris vibrioformis DSM 265
Start position: 1660793
End position: 1660819
Length: 27

DNA sequence
>NC_009337, from 1660793 to 1660819 (27 bp); Prosthecochloris vibrioformis DSM 265 GATGAACCCGATGCACCCGAAGAACCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1660784-1661077	Sequence	Cvib_1489 - redox-active disulfide protein 2 (Protein is coded in complementary strand; from 1661077 to 1660784)