Sequence retrieval

Genome: Prosthecochloris vibrioformis DSM 265
Start position: 1936297
End position: 1936320
Length: 24

DNA sequence
>NC_009337, from 1936297 to 1936320 (24 bp); Prosthecochloris vibrioformis DSM 265 TCTTTTTCTGTTTGTTTTTCTTTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1936287-1936673	Sequence	Cvib_1744 - hypothetical protein (Protein is coded in complementary strand; from 1936673 to 1936287)