Sequence retrieval

Genome: Prosthecochloris vibrioformis DSM 265
Start position: 1421496
End position: 1421519
Length: 24

DNA sequence
>NC_009337, from 1421496 to 1421519 (24 bp); Prosthecochloris vibrioformis DSM 265 GTCATGGTCATCATCATGGTGATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1421229-1422578	Sequence	Cvib_1271 - PUCC protein (Protein is coded in complementary strand; from 1422578 to 1421229)