Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 959214
End position: 959243
Length: 30

DNA sequence
>NC_009256, from 959214 to 959243 (30 bp); Burkholderia vietnamiensis G4 CGAGCGCCGCCGACCGCTGCCGAGCACCTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 959243-961171	Sequence	Bcep1808_0881 - bifunctional glucokinase/RpiR family transcriptional regulator (Protein is coded in complementary strand; from 961171 to 959243)