Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 95521
End position: 95548
Length: 28

DNA sequence
>NC_009256, from 95521 to 95548 (28 bp); Burkholderia vietnamiensis G4 ATCATGCCTCATGCCTCATGCGTCATGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 95544-96527	Sequence	Bcep1808_0088 phhA phenylalanine 4-monooxygenase (Protein is coded in complementary strand; from 96527 to 95544)