Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 803087
End position: 803122
Length: 36

DNA sequence
>NC_009256, from 803087 to 803122 (36 bp); Burkholderia vietnamiensis G4 GGACGAAGTGGACGAAGTGGACGAAGTGGACGAAGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 802284-804329	Sequence	Bcep1808_0724 mutL DNA mismatch repair protein (Protein is coded in complementary strand; from 804329 to 802284)