Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 793260
End position: 793286
Length: 27

DNA sequence
>NC_009256, from 793260 to 793286 (27 bp); Burkholderia vietnamiensis G4 CAAGCACCTCAAGCACCTCAAGCACCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 792127-794271	Sequence	Bcep1808_0714 - anthranilate synthase component I/chorismate-binding protein