Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 746038
End position: 746064
Length: 27

DNA sequence
>NC_009256, from 746038 to 746064 (27 bp); Burkholderia vietnamiensis G4 TGGCGGTGGTGGCGGTAGTGGCGCTGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 744621-746189	Sequence	Bcep1808_0679 - peptidase S41 (Protein is coded in complementary strand; from 746189 to 744621)