Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 736719
End position: 736742
Length: 24

DNA sequence
>NC_009256, from 736719 to 736742 (24 bp); Burkholderia vietnamiensis G4 CGCGTGCGCGTCGGCGTGCGCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 734695-736818	Sequence	Bcep1808_0670 - site-specific recombinase-like protein (Protein is coded in complementary strand; from 736818 to 734695)