Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 732825
End position: 732848
Length: 24

DNA sequence
>NC_009256, from 732825 to 732848 (24 bp); Burkholderia vietnamiensis G4 GGTTGCGGGTGCGTTTGCGTTTGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 732448-732864	Sequence	Bcep1808_0668 - glyoxalase/bleomycin resistance protein/dioxygenase (Protein is coded in complementary strand; from 732864 to 732448)