Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 635307
End position: 635351
Length: 45

DNA sequence
>NC_009256, from 635307 to 635351 (45 bp); Burkholderia vietnamiensis G4 TGCTTCAACCTGCGCTGCTTCGGCCGGCGCTGCCTCAACCGGCGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 633811-635580	Sequence	Bcep1808_0577 - FHA domain-containing protein (Protein is coded in complementary strand; from 635580 to 633811)