Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 61389
End position: 61412
Length: 24

DNA sequence
>NC_009256, from 61389 to 61412 (24 bp); Burkholderia vietnamiensis G4 CGACCGCGACGGCCACCGCGACCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 61298-61774	Sequence	Bcep1808_0053 - LrgA family protein (Protein is coded in complementary strand; from 61774 to 61298)