Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 3484584
End position: 3484607
Length: 24

DNA sequence
>NC_009256, from 3484584 to 3484607 (24 bp); Burkholderia vietnamiensis G4 GAAGAAGAAGGAGAAGAAGACGAA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3483582-3484967	Sequence	Bcep1808_3145 - hypothetical protein (Protein is coded in complementary strand; from 3484967 to 3483582)