Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 3471531
End position: 3471563
Length: 33

DNA sequence
>NC_009256, from 3471531 to 3471563 (33 bp); Burkholderia vietnamiensis G4 CGCGTGAGGTGCGCGTGAGGTGCGCGTCAGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 3471558-3472667	Sequence	Bcep1808_3133 - FAD dependent oxidoreductase (Protein is coded in complementary strand; from 3472667 to 3471558)