Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 3450648
End position: 3450683
Length: 36

DNA sequence
>NC_009256, from 3450648 to 3450683 (36 bp); Burkholderia vietnamiensis G4 CGTCGTGTCGCTCGCCGTGTCGCTCGTCGTGGCGGT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3449446-3451320	Sequence	Bcep1808_3114 - peptidase M24 (Protein is coded in complementary strand; from 3451320 to 3449446)