Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 3370719
End position: 3370745
Length: 27

DNA sequence
>NC_009256, from 3370719 to 3370745 (27 bp); Burkholderia vietnamiensis G4 GCTCTGCCTGCTCTGCCTGCTCTGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3370358-3371413	Sequence	Bcep1808_3038 - LysR family transcriptional regulator (Protein is coded in complementary strand; from 3371413 to 3370358)