Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 3263573
End position: 3263605
Length: 33

DNA sequence
>NC_009256, from 3263573 to 3263605 (33 bp); Burkholderia vietnamiensis G4 CTGGAACTTCGCTGAAACTGCGCTGAAACTTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF.. 3263433-3263573	Sequence	Bcep1808_2945 - hypothetical protein (Protein is coded in complementary strand; from 3263573 to 3263433)