Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 3047438
End position: 3047464
Length: 27

DNA sequence
>NC_009256, from 3047438 to 3047464 (27 bp); Burkholderia vietnamiensis G4 GTGCTGATTGTTCTGATTGTTCTGATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3047397-3048647	Sequence	Bcep1808_2754 - BNR repeat-containing glycosyl hydrolase