Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 3011786
End position: 3011809
Length: 24

DNA sequence
>NC_009256, from 3011786 to 3011809 (24 bp); Burkholderia vietnamiensis G4 GCGCCCGCGCACGCGCCTGCGCCT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 3011017-3012540	Sequence	Bcep1808_2721 - RND efflux system outer membrane lipoprotein (Protein is coded in complementary strand; from 3012540 to 3011017)