Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 2827625
End position: 2827649
Length: 25

DNA sequence
>NC_009256, from 2827625 to 2827649 (25 bp); Burkholderia vietnamiensis G4 ACGCGACGCTGCGCGACACGCCGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2827294-2828043	Sequence	Bcep1808_2553 - uroporphyrin-III C-methyltransferase (Protein is coded in complementary strand; from 2828043 to 2827294)