Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 2635010
End position: 2635033
Length: 24

DNA sequence
>NC_009256, from 2635010 to 2635033 (24 bp); Burkholderia vietnamiensis G4 CGAGCGCGATCGCGAACGCGACCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2634187-2635992	Sequence	Bcep1808_2373 - potassium-transporting ATPase subunit A (Protein is coded in complementary strand; from 2635992 to 2634187)