Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 2628949
End position: 2628984
Length: 36

DNA sequence
>NC_009256, from 2628949 to 2628984 (36 bp); Burkholderia vietnamiensis G4 GGTGTCGTCGGTGTCGTCGGTGTCGTCGGTGTCGTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2628217-2631210	Sequence	Bcep1808_2370 - osmosensitive K+ channel signal transduction histidine kinase (Protein is coded in complementary strand; from 2631210 to 2628217)