Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 2484414
End position: 2484437
Length: 24

DNA sequence
>NC_009256, from 2484414 to 2484437 (24 bp); Burkholderia vietnamiensis G4 GCCGAGGCCGCGGCCGAGACCGAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2480647-2484831	Sequence	Bcep1808_2234 - ATP-dependent helicase HrpA (Protein is coded in complementary strand; from 2484831 to 2480647)