Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 2428731
End position: 2428754
Length: 24

DNA sequence
>NC_009256, from 2428731 to 2428754 (24 bp); Burkholderia vietnamiensis G4 GCGCCGGCGCCAGCGCAGACGCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2427103-2429613	Sequence	Bcep1808_2190 - DNA internalization-related competence protein ComEC/Rec2 (Protein is coded in complementary strand; from 2429613 to 2427103)