Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 2407724
End position: 2407747
Length: 24

DNA sequence
>NC_009256, from 2407724 to 2407747 (24 bp); Burkholderia vietnamiensis G4 CGTCTTCCTCTTCGTCCTCGTCTT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2407693-2408241	Sequence	Bcep1808_2170 - FKBP-type peptidyl-prolyl cis-trans isomerase 2-like protein (Protein is coded in complementary strand; from 2408241 to 2407693)