Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 1907748
End position: 1907777
Length: 30

DNA sequence
>NC_009256, from 1907748 to 1907777 (30 bp); Burkholderia vietnamiensis G4 TCGTTCAATGCGGTTCAATGCAGTTCAATG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF... 1907773-1910415	Sequence	Bcep1808_1754 - DNA polymerase III subunits gamma and tau (Protein is coded in complementary strand; from 1910415 to 1907773)