Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 1868755
End position: 1868781
Length: 27

DNA sequence
>NC_009256, from 1868755 to 1868781 (27 bp); Burkholderia vietnamiensis G4 TCGCCGCGCTCGCCGCGGTGGCCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1867050-1868924	Sequence	Bcep1808_1718 - poly(R)-hydroxyalkanoic acid synthase, class I (Protein is coded in complementary strand; from 1868924 to 1867050)