Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 1596761
End position: 1596787
Length: 27

DNA sequence
>NC_009256, from 1596761 to 1596787 (27 bp); Burkholderia vietnamiensis G4 TCGTGCCGCTGGTGCCGCTCGTCCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1595602-1596954	Sequence	Bcep1808_1481 - hypothetical protein (Protein is coded in complementary strand; from 1596954 to 1595602)