Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 1555099
End position: 1555123
Length: 25

DNA sequence
>NC_009256, from 1555099 to 1555123 (25 bp); Burkholderia vietnamiensis G4 CGCCGCGCAGCTCCGCGCCGCGGCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1554735-1556945	Sequence	Bcep1808_1447 - hypothetical protein (Protein is coded in complementary strand; from 1556945 to 1554735)