Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 1237495
End position: 1237518
Length: 24

DNA sequence
>NC_009256, from 1237495 to 1237518 (24 bp); Burkholderia vietnamiensis G4 CGGCGTCGACGTGGGCGTCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1235613-1237544	Sequence	Bcep1808_1132 - thiamine biosynthesis protein ThiC (Protein is coded in complementary strand; from 1237544 to 1235613)