Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 1156251
End position: 1156275
Length: 25

DNA sequence
>NC_009256, from 1156251 to 1156275 (25 bp); Burkholderia vietnamiensis G4 CGCGGCGCTGCGCGCAGCGGCGCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1156222-1157094	Sequence	Bcep1808_1072 - membrane protein (Protein is coded in complementary strand; from 1157094 to 1156222)