Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 1066452
End position: 1066481
Length: 30

DNA sequence
>NC_009256, from 1066452 to 1066481 (30 bp); Burkholderia vietnamiensis G4 CGCGCGCGGCGGCGCGCTGCCGTCCGCGGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1065691-1066620	Sequence	Bcep1808_0979 - acylglycerol lipase (Protein is coded in complementary strand; from 1066620 to 1065691)