Sequence retrieval

Genome: Burkholderia vietnamiensis G4
Start position: 1011736
End position: 1011771
Length: 36

DNA sequence
>NC_009256, from 1011736 to 1011771 (36 bp); Burkholderia vietnamiensis G4 GATCACGGCGCCGATCACCGCGACGATCACCGAGCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1011698-1011952	Sequence	Bcep1808_0933 - transglycosylase-associated protein (Protein is coded in complementary strand; from 1011952 to 1011698)