Sequence retrieval

Genome: Halorhodospira halophila SL1
Start position: 981823
End position: 981846
Length: 24

DNA sequence
>NC_008789, from 981823 to 981846 (24 bp); Halorhodospira halophila SL1 CCTCGGCCACGGCCTCGGCATCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 981465-982880	Sequence	Hhal_0908 - peptidase M20 (Protein is coded in complementary strand; from 982880 to 981465)