Sequence retrieval

Genome: Halorhodospira halophila SL1
Start position: 812046
End position: 812069
Length: 24

DNA sequence
>NC_008789, from 812046 to 812069 (24 bp); Halorhodospira halophila SL1 TCGGCGGCGGCGTAGGCGTCGTCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 811770-812672	Sequence	Hhal_0726 - ornithine carbamoyltransferase (Protein is coded in complementary strand; from 812672 to 811770)