Sequence retrieval

Genome: Halorhodospira halophila SL1
Start position: 757099
End position: 757123
Length: 25

DNA sequence
>NC_008789, from 757099 to 757123 (25 bp); Halorhodospira halophila SL1 GCCGCGCGGCGCCGAGCCGCGCCGC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 757065-757922	Sequence	Hhal_0674 - pantoate--beta-alanine ligase (Protein is coded in complementary strand; from 757922 to 757065)