Sequence retrieval

Genome: Halorhodospira halophila SL1
Start position: 729489
End position: 729513
Length: 25

DNA sequence
>NC_008789, from 729489 to 729513 (25 bp); Halorhodospira halophila SL1 GATCCGCTCCGATCGGATCTGCTCC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 729259-729681	Sequence	Hhal_0648 - hypothetical protein (Protein is coded in complementary strand; from 729681 to 729259)