Sequence retrieval

Genome: Halorhodospira halophila SL1
Start position: 717874
End position: 717906
Length: 33

DNA sequence
>NC_008789, from 717874 to 717906 (33 bp); Halorhodospira halophila SL1 GATCGTGCCGGGATTGTGTCGGGTTTGTGCCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 717264-718244	Sequence	Hhal_0639 - hypothetical protein (Protein is coded in complementary strand; from 718244 to 717264)