Sequence retrieval

Genome: Halorhodospira halophila SL1
Start position: 442960
End position: 442995
Length: 36

DNA sequence
>NC_008789, from 442960 to 442995 (36 bp); Halorhodospira halophila SL1 CATGAACTCCATGAACTCCATGAACTCCATGAACTC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 442784-443113	Sequence	Hhal_0378 - hypothetical protein (Protein is coded in complementary strand; from 443113 to 442784)