Sequence retrieval

Genome: Halorhodospira halophila SL1
Start position: 362453
End position: 362479
Length: 27

DNA sequence
>NC_008789, from 362453 to 362479 (27 bp); Halorhodospira halophila SL1 TTCGCCATTTTCGCCATTTTCGCCATT
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 362433-362990	Sequence	Hhal_0321 - hypothetical protein (Protein is coded in complementary strand; from 362990 to 362433)