Sequence retrieval

Genome: Halorhodospira halophila SL1
Start position: 2602788
End position: 2602811
Length: 24

DNA sequence
>NC_008789, from 2602788 to 2602811 (24 bp); Halorhodospira halophila SL1 GGACCGGGATCGGTACCGGGATCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2601254-2603200	Sequence	Hhal_2368 - peptidase S8/S53 subtilisin kexin sedolisin