Sequence retrieval

Genome: Halorhodospira halophila SL1
Start position: 2398919
End position: 2398942
Length: 24

DNA sequence
>NC_008789, from 2398919 to 2398942 (24 bp); Halorhodospira halophila SL1 CCCCGGCACCCCGGCCCACCGGCA
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2397544-2399808	Sequence	Hhal_2185 - heavy metal translocating P-type ATPase (Protein is coded in complementary strand; from 2399808 to 2397544)