Sequence retrieval

Genome: Halorhodospira halophila SL1
Start position: 231248
End position: 231271
Length: 24

DNA sequence
>NC_008789, from 231248 to 231271 (24 bp); Halorhodospira halophila SL1 CACCAGCACCAGGACCAGCACCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 230799-231311	Sequence	Hhal_0198 - ankyrin (Protein is coded in complementary strand; from 231311 to 230799)