Sequence retrieval

Genome: Halorhodospira halophila SL1
Start position: 2236801
End position: 2236824
Length: 24

DNA sequence
>NC_008789, from 2236801 to 2236824 (24 bp); Halorhodospira halophila SL1 CAGCAGCTGCAGCGGCAGCAGCAC
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2236439-2236867	Sequence	Hhal_2034 - putative monovalent cation/H+ antiporter subunit B (Protein is coded in complementary strand; from 2236867 to 2236439)