Sequence retrieval

Genome: Halorhodospira halophila SL1
Start position: 2059809
End position: 2059832
Length: 24

DNA sequence
>NC_008789, from 2059809 to 2059832 (24 bp); Halorhodospira halophila SL1 CGGCGGCGGTGGCGGCGCCGGCGG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 2058614-2062111	Sequence	Hhal_1880 - chromosome segregation protein SMC (Protein is coded in complementary strand; from 2062111 to 2058614)