Sequence retrieval

Genome: Halorhodospira halophila SL1
Start position: 1459368
End position: 1459391
Length: 24

DNA sequence
>NC_008789, from 1459368 to 1459391 (24 bp); Halorhodospira halophila SL1 GTGGTGGTGGTGATGGTGGTGGTG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1459366-1460190	Sequence	Hhal_1350 - cobalamin (vitamin B12) biosynthesis CbiX protein (Protein is coded in complementary strand; from 1460190 to 1459366)