Sequence retrieval

Genome: Halorhodospira halophila SL1
Start position: 1453688
End position: 1453711
Length: 24

DNA sequence
>NC_008789, from 1453688 to 1453711 (24 bp); Halorhodospira halophila SL1 CACCCGCACCTGCTCCCGCATCCG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1452741-1454195	Sequence	Hhal_1343 - uroporphyrin-III C-methyltransferase (Protein is coded in complementary strand; from 1454195 to 1452741)