Sequence retrieval

Genome: Halorhodospira halophila SL1
Start position: 1090134
End position: 1090158
Length: 25

DNA sequence
>NC_008789, from 1090134 to 1090158 (25 bp); Halorhodospira halophila SL1 CGCCGCGCCGTGCCGCGTCGCGCAG
Translate to protein
Restriction digest
BLAST
Design primers with primer3
Genome related info at NCBI

Gene(s) or part of gene(s) amplified:
ORF. 1090025-1090711	Sequence	Hhal_1018 - nucleotidyl transferase (Protein is coded in complementary strand; from 1090711 to 1090025)